Unravelling the selectivity of 6,7 dimethyl Quinoxaline analogues for kinase inhibition: An Insight towards the development of Alzheimer's therapeutics

Unravelling the selectivity of 6,7 dimethyl Quinoxaline analogues for kinase inhibition: An Insight towards the development of Alzheimer’s therapeutics

Untangling probably the most selective kinase inhibitors by way of pharmacological intervention stays one of many difficult affairs thus far. Inaccordance to this drift, herein we describe the design and synthesis of a set of recent heterocyclic analogues consisting of 6,7 dimethyl Quinoxaline, appended to a connector, using Schiff base technique (Compounds I – IX ).
The compounds had been characterised by numerous spectroscopic strategies and the kinase inhibition assay had been carried out on few prime members of the CMGC household specifically the GSK3 b , DYRK1A and CLK1 receptors respectively, which were identified to be straight concerned in hyperphosphorylation of Tau.
Curiously the organic analysis outcomes revealed that Compounds IV & V , with bromo/chloro functionalities within the fragrant core had been advantaged of being extremely selective in the direction of the goal GSK3b over others.
To strengthen our evaluation, we adopted molecular modelling research, the place compounds IV /V had been redocked in the identical grid 4AFJ, as that of the reference ligand, 5-Aryl-4-Carboxamide-1,3-Oxazole. Surprisingly, our investigation underpined that for each the compounds IV/V, a major H-bonding existed between the designed molecules ( IV/V) and Val 135 residue within the receptor GSK3b, inline with the reference ligand. We attribute this interplay to instigate efficiency within the compounds.
Certainly the opposite non-covalent interplay, between the by-product’s fragrant nucleus and Arg 141/Thr 138 within the receptor GSK3b, might need been answerable for enhancing the selectivity within the targets. Total, we really feel that the current work depicts a logical demonstration in the direction of advantageous tuning the efficacy of the inhibitors by way of systematic adjustment of electron density at acceptable positions within the fragrant ring be it the primary quinoxaline or the opposite fragrant nucleus. Thus this pathway presents a handy technique for the event of environment friendly therapeutics for diversified neurodegenerative ailments like that of Alzheimer’s.

GSK3 as a Regulator of Cytoskeleton Structure: Penalties for Well being and Illness

Glycogen synthase kinase 3 (GSK3) was initially remoted as a vital protein in vitality metabolism. Nonetheless, subsequent research point out that GSK-Three is a multi-tasking kinase that hyperlinks quite a few signaling pathways in a cell and performs an important position within the regulation of many elements of mobile physiology.
As a regulator of actin and tubulin cytoskeleton, GSK3 influences processes of cell polarization, interplay with the extracellular matrix, and directional migration of cells and their organelles throughout the progress and growth of an animal organism. On this assessment, the roles of GSK3-cytoskeleton interactions in mind growth and pathology, migration of wholesome and most cancers cells, and in mobile trafficking of mitochondria shall be mentioned.
Unravelling the selectivity of 6,7 dimethyl Quinoxaline analogues for kinase inhibition: An Insight towards the development of Alzheimer's therapeutics

An Overview of the Security, Effectivity, and Sign Pathways of Stem Cell Remedy for Systemic Lupus Erythematosus

Systemic lupus erythematosus (SLE) is an autoimmune illness that impacts a number of organs and tissues. Mesenchymal stem cells (MSCs) are thought-about a great supply for autoimmune illness and hematological illness remedy. This assessment will summarize the efficacy, security, and mechanisms of MSC remedy for SLE.
MSC remedy can scale back anti-dsDNA, antinuclear antigen (ANA), proteinuria, and serum creatinine in SLE sufferers. In animal fashions of SLE, MSC remedy additionally signifies that it might scale back anti-dsDNA, ANA, proteinuria, and serum creatinine and ameliorate renal pathology.
There aren’t any severe hostile occasions, treatment-related mortality, or tumor-related occasions in SLE sufferers after stem cell therapy. MSCs can inhibit inflammatory components, equivalent to MCP-1 and HMGB-1, and inhibit inflammation-related signaling pathways, such because the NF-κB, JAK/STAT, and Akt/GSK3β signaling pathways, to alleviate the lesions in SLE.

Mitotic WNT signalling orchestrates neurogenesis within the growing neocortex

The position of WNT/β-catenin signalling in mouse neocortex growth stays ambiguous. Most research reveal that WNT/β-catenin regulates progenitor self-renewal however others counsel it could additionally promote differentiation. Right here we discover the position of WNT/STOP signalling, which stabilizes proteins throughout G2/M by inhibiting glycogen synthase kinase (GSK3)-mediated protein degradation.
We present that mice mutant for cyclin Y and cyclin Y-like 1 (Ccny/l1), key regulators of WNT/STOP signalling, show decreased neurogenesis within the growing neocortex. Particularly, basal progenitors, which exhibit delayed cell cycle development, had been drastically decreased. Ccny/l1-deficient apical progenitors present decreased uneven division attributable to a rise in apical-basal astral microtubules.
We establish the neurogenic transcription components Sox4 and Sox11 as direct GSK3 targets which are stabilized by WNT/STOP signalling in basal progenitors throughout mitosis and that promote neuron technology. Our work reveals that WNT/STOP signalling drives cortical neurogenesis and identifies mitosis as a vital part for neural progenitor destiny.

GSK3s: nodes of multilayer regulation of plant growth and stress responses

Glycogen synthase kinase 3 (GSK3) relations are extremely conserved serine/threonine protein kinases in eukaryotes. Not like animals, vegetation have developed with a number of homologs of GSK3s concerned in a various array of organic processes. Rising proof means that GSK3s act as signaling hubs for integrating notion and transduction of numerous indicators required for plant growth and responses to abiotic and biotic cues.
Right here we assessment current advances in understanding the molecular interactions between GSK3s and an increasing spectrum of their upstream regulators and downstream substrates in vegetation. We additional focus on how GSK3s act as key signaling nodes of multilayer regulation of plant growth and stress response by way of both being regulated on the post-translational degree or regulating their substrates by way of phosphorylation.

GSK3-SRF Axis Mediates Angiotensin II Induced Endothelin Transcription in Vascular Endothelial Cells

Endothelin, encoded by ET1, is a vasoactive substance primarily synthesized in vascular endothelial cells (VECs). Elevation of endothelin ranges, attributable to transcriptional hyperactivation, has been noticed in a bunch of cardiovascular ailments. We now have beforehand proven that serum response issue (SRF) is a regulator of ET1 transcription in VECs.
Right here we report that angiotensin II (Ang II) induced ET1 transcription paralleled activation of glycogen synthase kinase 3 (GSK3) in cultured VECs. GSK3 knockdown or pharmaceutical inhibition attenuated Ang II induced endothelin expression.
Unravelling the selectivity of 6,7 dimethyl Quinoxaline analogues for kinase inhibition: An Insight towards the development of Alzheimer's therapeutics
Of curiosity, the impact of GSK3 on endothelin transcription relied on the conserved SRF motif inside the ET1 promoter. Additional evaluation revealed that GSK3 interacted with and phosphorylated SRF at serine 224. Phosphorylation of SRF by GSK3 didn’t affect its recruitment to the ET1 promoter.
As an alternative, GSK3-mediated SRF phosphorylation potentiated its interplay with MRTF-A, a key co-factor for SRF, which helped recruit the chromatin transforming protein BRG1 to the ET1 promoter leading to augmented histone H3 acetylation/H3K4 trimethylation.

Anti-GSK3B antibody

PAab03673 100 ug
EUR 355

Anti-GSK3B antibody

PAab03674 100 ug
EUR 355

Anti-GSK3B antibody

PAab03675 100 ug
EUR 412

Anti-GSK3B antibody

PAab03676 100 ug
EUR 386

Anti-GSK3B Antibody

STJ501295 100 µg
EUR 476

Anti-GSK3B antibody

STJ27912 100 µl
EUR 413
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ23879 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ23880 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ113773 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ113841 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ119229 100 µl
EUR 277

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-GSK3B Antibody (Biotin)

STJ501296 100 µg
EUR 586

Anti-GSK3B Antibody (FITC)

STJ501297 100 µg
EUR 586

anti-GSK3B (3D10)

LF-MA30340 100 ul
EUR 486
Description: Mouse Monoclonal to GSK3B

Anti-GSK3b (Ab-9) Antibody

A00791-1 100ul
EUR 397
Description: Rabbit Polyclonal GSK3b (Ab-9) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-Phospho-GSK3B-(Y216) antibody

STJ110852 100 µl
EUR 393
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Phospho-GSK3B-(Y216) antibody

STJ116370 100 µl
EUR 393
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Phospho-GSK3B-(S9) antibody

STJ22160 100 µl
EUR 393
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Hu-48T 48T
EUR 517
  • Should the Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Hu-96T 96T
EUR 673
  • Should the Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Mu-48T 48T
EUR 527
  • Should the Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Mu-96T 96T
EUR 688
  • Should the Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Ra-48T 48T
EUR 549
  • Should the Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Ra-96T 96T
EUR 718
  • Should the Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Hu-48Tests 48 Tests
EUR 521

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Hu-96Tests 96 Tests
EUR 723

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Mu-48Tests 48 Tests
EUR 533

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Mu-96Tests 96 Tests
EUR 740

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Ra-48Tests 48 Tests
EUR 557

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Ra-96Tests 96 Tests
EUR 775

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Hu-48Tests 48 Tests
EUR 544

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Hu-96Tests 96 Tests
EUR 756

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Mu-48Tests 48 Tests
EUR 557

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Mu-96Tests 96 Tests
EUR 774

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Ra-48Tests 48 Tests
EUR 583

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Ra-96Tests 96 Tests
EUR 811

GSK3B Antibody

BF0695 200ul
EUR 376
Description: GSK3B antibody detects endogenous levels of total GSK3B.

GSK3B Antibody

ABD6806 100 ug
EUR 438

GSK3B Antibody

ABD7231 100 ug
EUR 438

GSK3B Antibody

36918-100ul 100ul
EUR 252

GSK3B antibody

38353-100ul 100ul
EUR 252

GSK3B antibody

38616-100ul 100ul
EUR 252

GSK3B antibody

10R-1862 100 ul
EUR 403
Description: Mouse monoclonal GSK3B antibody

GSK3B antibody

70R-17615 50 ul
EUR 435
Description: Rabbit polyclonal GSK3B antibody

GSK3b antibody

70R-11869 100 ug
EUR 418
Description: Rabbit polyclonal GSK3b antibody

GSK3B antibody

70R-15005 100 ul
EUR 392
Description: Rabbit polyclonal GSK3B antibody

GSK3B Antibody

DF7231 200ul
EUR 304
Description: GSK3B Antibody detects endogenous levels of total GSK3B.

GSK3B Antibody

CSB-PA939628-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GSK3B Antibody

CSB-PA939628-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GSK3B Antibody

1-CSB-PA002848
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/20000

GSK3B Antibody

1-CSB-PA009038
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

GSK3B Antibody

1-CSB-PA009963GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat, Pig. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GSK3B Antibody

1-CSB-PA009963LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:500

GSK3B Antibody

1-CSB-PA080166
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

GSK3B Conjugated Antibody

C36918 100ul
EUR 397

GSK3B Conjugated Antibody

C38353 100ul
EUR 397

GSK3B (pY216) Antibody

20-abx123289
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GSK3B (pY216) Antibody

20-abx000312
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GSK3A / GSK3B Antibody

20-abx328487
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GSK3B Polyclonal Antibody

A62706 100 µg
EUR 570.55
Description: reagents widely cited

Phospho-GSK3b antibody

70R-11870 100 ug
EUR 525
Description: Rabbit polyclonal Phospho-GSK3b antibody

GSK3A/GSK3B Antibody

1-CSB-PA002838
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GSK3A/GSK3B. Recognizes GSK3A/GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

GSK3B siRNA

20-abx902344
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSK3B siRNA

20-abx918789
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSK3B siRNA

20-abx918790
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSK3B Plasmid

PVT7113 2 ug
EUR 266

Rabbit Anti-GSK3B monoclonal antibody, clone TZ13-82

DCABH-9320 100 ul
EUR 777

Rabbit Anti-Human GSK3B Polyclonal Antibody, Phospho-Tyr216

CPB-820RH 100 ul
EUR 559

GSK3B Polyclonal Conjugated Antibody

C30706 100ul
EUR 397

GSK3B (pS21 / 29) Antibody

abx031864-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GSK3B (pS21 / 29) Antibody

abx031864-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phospho-GSK3B (S9) Antibody

1-CSB-PA000536
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-GSK3B (S9). Recognizes Phospho-GSK3B (S9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/5000

Phospho-GSK3B (S9) Antibody

1-CSB-PA000636
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-GSK3B (S9). Recognizes Phospho-GSK3B (S9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GSK3B Antibody, HRP conjugated

1-CSB-PA009963LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSK3B Antibody, FITC conjugated

1-CSB-PA009963LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSK3B Antibody, Biotin conjugated

1-CSB-PA009963LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-GSK3B (Ser9) Antibody

CSB-PA166926-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3B (Ser9). Recognizes Phospho-GSK3B (Ser9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-GSK3B (Ser9) Antibody

CSB-PA166926-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3B (Ser9). Recognizes Phospho-GSK3B (Ser9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

GSK3B (Ab-9) Antibody

CSB-PA120951-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3B (Ab-9). Recognizes GSK3B (Ab-9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

GSK3B (Ab-9) Antibody

CSB-PA120951-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3B (Ab-9). Recognizes GSK3B (Ab-9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

Rabbit Anti-GSK3A, GSK3B monoclonal antibody, clone TZ37-16

CABT-L635 100 ul
EUR 777

Rabbit Anti-Human GSK3B (aa 214-218) Polyclonal Antibody

CPB-1178RH 100 ul
EUR 460

Anti-Glycogen synthase kinase 3 B (GSK3B) (Ser9) antibody

STJ120111 100 µl
EUR 526

Polyclonal GSK3B / GSK3 Beta Antibody

AMM05221G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSK3B / GSK3 Beta . This antibody is tested and proven to work in the following applications:

Monoclonal GSK3B Antibody, Clone: 3D6B4

AMM05223G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GSK3B. The antibodies are raised in Mouse and are from clone 3D6B4. This antibody is applicable in WB and IHC, FC, E

GSK3A / GSK3B (pY279 / 216) Antibody

20-abx328488
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GSK3A / GSK3B (pY279 / 216) Antibody

abx333212-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

GSK3B Polyclonal Antibody, HRP Conjugated

A62707 100 µg
EUR 570.55
Description: Ask the seller for details

GSK3B Polyclonal Antibody, FITC Conjugated

A62708 100 µg
EUR 570.55
Description: The best epigenetics products

GSK3B Polyclonal Antibody, Biotin Conjugated

A62709 100 µg
EUR 570.55
Description: kits suitable for this type of research

[KO Validated] GSK3B Polyclonal Antibody

30706-100ul 100ul
EUR 252

[KO Validated] GSK3B Polyclonal Antibody

30706-50ul 50ul
EUR 187

Antibody for Human GSK3b (pSer9)

SPC-1384D 0.1ml
EUR 354
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is unconjugated.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A390 0.1ml
EUR 401
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 390.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A488 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 488.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A565 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 565.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A594 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 594.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A633 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 633.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A655 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 655.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A680 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 680.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A700 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 700.

Antibody for Human GSK3b (pSer9)

SPC-1384D-ALP 0.1ml
EUR 394
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human GSK3b (pSer9)

SPC-1384D-APC 0.1ml
EUR 399
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to APC .

Antibody for Human GSK3b (pSer9)

SPC-1384D-APCCY7 0.1ml
EUR 471
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to APC/Cy7.

Antibody for Human GSK3b (pSer9)

SPC-1384D-BI 0.1ml
EUR 396
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Biotin.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY350 0.1ml
EUR 414
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 350.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY405 0.1ml
EUR 403
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 405.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY488 0.1ml
EUR 393
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 488.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY594 0.1ml
EUR 395
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 594.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY633 0.1ml
EUR 390
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 633.

Antibody for Human GSK3b (pSer9)

SPC-1384D-FITC 0.1ml
EUR 392
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to FITC.

Antibody for Human GSK3b (pSer9)

SPC-1384D-HRP 0.1ml
EUR 388
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to HRP.

Antibody for Human GSK3b (pSer9)

SPC-1384D-P594 0.1ml
EUR 407
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to PE/ATTO 594.

Antibody for Human GSK3b (pSer9)

SPC-1384D-PCP 0.1ml
EUR 399
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to PerCP.

Antibody for Human GSK3b (pSer9)

SPC-1384D-RPE 0.1ml
EUR 397
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to RPE .

Antibody for Human GSK3b (pSer9)

SPC-1384D-STR 0.1ml
EUR 398
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Streptavidin.

GSK3B Blocking Peptide

BF0695-BP 1mg
EUR 195

GSK3B cloning plasmid

CSB-CL009963HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgtcagggcggcccagaaccacctcctttgcggagagctgcaagccggtgcagcagccttcagcttttggcagcatgaaagttagcagagacaaggacggcagcaaggtgacaacagtggtggcaactcctgggcagggtccagacaggccacaagaagtcagctatacagaca
  • Show more
Description: A cloning plasmid for the GSK3B gene.

GSK3B Rabbit mAb

A10877-100ul 100 ul
EUR 384

GSK3B Rabbit mAb

A10877-200ul 200 ul
EUR 554

GSK3B Rabbit mAb

A10877-20ul 20 ul Ask for price

GSK3B Rabbit mAb

A10877-50ul 50 ul
EUR 265

GSK3B Rabbit pAb

A11360-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A11360-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A11360-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A11360-50ul 50 ul
EUR 223

GSK3B Rabbit pAb

A11578-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A11578-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A11578-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A11578-50ul 50 ul
EUR 223

GSK3B Rabbit pAb

A3174-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A3174-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A3174-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A3174-50ul 50 ul
EUR 223

GSK3B Rabbit pAb

A2081-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A2081-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A2081-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A2081-50ul 50 ul
EUR 223

GSK3B Rabbit pAb

A16868-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A16868-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A16868-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A16868-50ul 50 ul
EUR 223

GSK3b Blocking Peptide

33R-10782 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSK3b antibody, catalog no. 70R-11869

GSK3B Blocking Peptide

DF7231-BP 1mg
EUR 195

Recombinant Human GSK3B

P0221 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P49841
Description: Recombinant Human protein for GSK3B

pT7- His- GSK3B

PVT10128 2 ug
EUR 301

Polyclonal Mouse Gsk3b Antibody (N-term)

APR04027G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Gsk3b (N-term). This antibody is tested and proven to work in the following applications:

GSK3A / GSK3B (Ab-279 / 216) Antibody

abx332166-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Phospho-GSK3A/GSK3B (Y279/216) Antibody

1-CSB-PA000535
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-GSK3A/GSK3B (Y279/216). Recognizes Phospho-GSK3A/GSK3B (Y279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Phospho-GSK3A/GSK3B (Tyr279/216) Antibody

CSB-PA575559-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3A/GSK3B (Tyr279/216). Recognizes Phospho-GSK3A/GSK3B (Tyr279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-GSK3A/GSK3B (Tyr279/216) Antibody

CSB-PA575559-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3A/GSK3B (Tyr279/216). Recognizes Phospho-GSK3A/GSK3B (Tyr279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

GSK3A/GSK3B (Ab-279/216) Antibody

CSB-PA255909-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3A/GSK3B (Ab-279/216). Recognizes GSK3A/GSK3B (Ab-279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

GSK3A/GSK3B (Ab-279/216) Antibody

CSB-PA255909-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3A/GSK3B (Ab-279/216). Recognizes GSK3A/GSK3B (Ab-279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Mouse GSK3B shRNA Plasmid

20-abx974854
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GSK3B shRNA Plasmid

20-abx986899
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GSK3B ELISA Kit

ELA-E2298h 96 Tests
EUR 824

GSK3B protein (His tag)

80R-3636 50 ug
EUR 435
Description: Purified recombinant GSK3B protein (His tag)

Human GSK3B shRNA Plasmid

20-abx951981
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GSK3B Recombinant Protein (Human)

RP061362 100 ug Ask for price

pcDNA3.1-Myc-GSK3B Plasmid

PVTB01013-2a 2 ug
EUR 356

pECMV- 3*Flag- GSK3B

PVT10270 2 ug
EUR 301

GSK3B Recombinant Protein (Rat)

RP203810 100 ug Ask for price

GSK3B Recombinant Protein (Mouse)

RP140201 100 ug Ask for price

Polyclonal GSK3B / GSK3 Beta Antibody (C-Terminus)

AMM05222G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSK3B / GSK3 Beta (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Bi-Phospho-GSK3B(S21/29) Antibody

APR07078G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bi-Phospho-GSK3B(S21/29) . This antibody is tested and proven to work in the following applications:

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx125048
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx125336
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx125917
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx112808
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

20-abx121488
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

20-abx000728
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx001694
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx002277
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx147405-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

20-abx134166
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx037712-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

abx033884-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

abx033884-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx010856-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx004714
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (Gsk3b) Antibody

abx028354-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (Gsk3b) Antibody

abx028354-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx172635
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx172636
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx176674
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx176675
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx328988
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx224101-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx329709
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx330217
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx332014-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx332790-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx318062
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

20-abx445135
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 25 ug
  • Shipped within 5-12 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx233673-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Constantly, over-expression of a constitutively energetic GSK enhanced Ang II-induced ET1 transcription and knockdown of both MRTF-A or BRG1 abrogated the enhancement of ET1 transcription. In conclusion, our information spotlight a beforehand unrecognized mechanism that contributes to the transcriptional regulation of endothelin. Concentrating on this GSK3-SRF axis could yield novel approaches within the intervention of cardiovascular ailments.

Leave a Reply

Your email address will not be published. Required fields are marked *