ATE1 inhibits liver cancer progression through RGS5-mediated suppression of Wnt/β-catenin signaling

ATE1 inhibits liver cancer progression through RGS5-mediated suppression of Wnt/β-catenin signaling

Arginyltransferase (ATE1) performs vital roles in lots of organic features together with cardiovascular growth, angiogenesis, adipogenesis, muscle contraction, and metastasis of most cancers. Nonetheless, the position of ATE1 in hepatocellular carcinoma (HCC) stays unknown. On this research, we discover that ATE1 performs an important position in progress and malignancy of liver most cancers.
ATE1 expression is considerably decreased in human HCC samples in comparison with regular liver tissue. Moreover, low ATE1 expression is correlated with aggressive clinicopathological options and is an unbiased poor prognostic issue for total survival and disease-free survival of HCC sufferers. Lentivirus-mediated ATE1 knockdown considerably promoted liver most cancers progress, migration and illness development in vitro and in vivo.
Opposing outcomes had been noticed when ATE1 was up-regulated. Mechanistically, ATE1 accelerated the degradation of β-catenin and inhibited Wnt signaling by regulating turnover of Regulator Of G Protein Signaling 5 (RGS5). Loss- and gain-of-function assays confirmed that RGS5 was a key effector of ATE1-mediated regulation of Wnt signaling.
Additional research indicated that RGS5 could be concerned in regulating the exercise of GSK3-β, a vital element of the cytoplasmic destruction complicated. Remedy with a GSK inhibitor (CHIR99021) cooperated with ablation of ATE1 or RGS5 overexpression to advertise Wnt/β-catenin signaling, however overexpression of ATE1 or RGS5 knockdown didn’t reverse the impact of GSK inhibitor. Implications: ATE1 inhibits liver most cancers development by suppressing Wnt/β-catenin signaling and may function a probably useful prognostic biomarker for HCC.

AGEs promote calcification of HASMCs by mediating Pi3k/AKT-GSK3β signaling

This research aimed to research the consequences of superior glycation finish merchandise (AGEs) on the calcification of human arterial easy muscle cells (HASMCs) and to discover whether or not AGEs can promote the calcification of HASMCs by activating the phosphoinositide 3-kinase (PI3K)/AKT-glycogen synthase kinase Three beta (GSK3-β) axis. Cultured HASMCs had been divided into 5 teams: clean management group, dimethyl sulfoxide (automobile) group, AGEs group, LY294002 (AKT inhibitor) group, and TWS119 (GSK3-β inhibitor) group.
Cells had been pretreated with both automobile, LY294002, or TWS119 for two hours adopted by incubation with AGEs (25 μg/mL) for five days, and the expression ranges of proteins in every group had been analyzed by western blotting. AGE therapy promoted HASMC calcification, which coincided with elevated expression of p-AKT and p-GSK3-β (serine 9).
Additionally, AGEs upregulated the expression of osteoprotegerin and bone morphogenetic protein, and these results had been suppressed by LY294002 however enhanced by TWS119. In conclusion, AGEs promote calcification of HASMCs, and this impact is ameliorated by inhibition of AKT exercise however potentiated by inhibition of GSK3-β exercise. Therefore, AGEs set off HASMC calcification by regulating PI3K/AKT-GSK3-β signaling.

GSK3 Inhibitor-Induced Dentinogenesis Utilizing a Hydrogel

Small-molecule medication concentrating on glycogen synthase kinase 3 (GSK3) as inhibitors of the protein kinase exercise are capable of stimulate reparative dentine formation. To develop this method right into a viable medical therapy for uncovered pulp lesions, we synthesized a novel, small-molecule noncompetitive adenosine triphosphate (ATP) drug that may be included right into a biodegradable hydrogel for placement by syringe into the tooth.
This new drug, named NP928, belongs to the thiadiazolidinone (TDZD) household and has equal exercise to related medication of this household equivalent to tideglusib. Nonetheless, NP928 is extra water soluble than different TDZD medication, making it extra appropriate for direct supply into pulp lesions.
We have now beforehand reported that biodegradable marine collagen sponges can efficiently ship TDZD medication to pulp lesions, however this entails in-theater preparation of the fabric, which isn’t best in a medical context.
To enhance surgical dealing with and supply, right here we included NP928 right into a particularly tailor-made hydrogel that may be positioned by syringe right into a broken tooth. This hydrogel is predicated on biodegradable hyaluronic acid and might be gelled in situ upon dental blue gentle publicity, equally to different frequent dental supplies.
NP928 launched from hyaluronic acid-based hydrogels upregulated Wnt/β-catenin exercise in pulp stem cells and fostered reparative dentine formation in comparison with marine collagen sponges delivering equal concentrations of NP928. This drug-hydrogel mixture has the potential to be quickly developed right into a therapeutic process that’s amenable to normal dental follow.

Direct P70S6K1 inhibition to exchange dexamethasone in synergistic mixture with MCL-1 inhibition in a number of myeloma

Novel mixture therapies have markedly improved the lifespan of sufferers with a number of myeloma (MM), however drug resistance and illness relapse stay main medical issues. Dexamethasone and different glucocorticoids are a cornerstone of standard and new mixture therapies for MM, though their use is accompanied by critical unwanted side effects.
We aimed to uncover drug combos that act in synergy and, as such, enable decreased dosing whereas remaining efficient. Dexamethasone and the myeloid cell leukemia 1 (MCL-1) inhibitor S63845 (MCL-1i) proved probably the most potent mixture in our lethality display screen and induced apoptosis of human myeloma cell strains (HMCLs) that was 50% greater in contrast with an additive drug impact.
Kinome evaluation of dexamethasone-treated HMCLs revealed a discount in serine/threonine peptide phosphorylation, which was predicted to consequence from decreased Akt exercise. Biochemical methods confirmed no dexamethasone-induced results on FOXO protein or GSK3 however did present a 50% discount in P70S6K phosphorylation, downstream of the Akt-mTORC1 axis.
Changing dexamethasone by the P70S6K1 isoform-specific inhibitor PF-4708671 (S6K1i) revealed related and statistically important synergistic apoptosis of HMCLs together with MCL-1i. Apparently, apoptosis induced by the P70S6K1i and MCL-1i mixture was more-than-additive in all 9 main MM samples examined; this impact was noticed for six of 9 samples with the dexamethasone and MCL-1i mixture.

Anti-GSK3B antibody

PAab03673 100 ug
EUR 355

Anti-GSK3B antibody

PAab03674 100 ug
EUR 355

Anti-GSK3B antibody

PAab03675 100 ug
EUR 412

Anti-GSK3B antibody

PAab03676 100 ug
EUR 386

Anti-GSK3B antibody

STJ27912 100 µl
EUR 413
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ113773 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ113841 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ119229 100 µl
EUR 277

Anti-GSK3B Antibody

STJ501295 100 µg
EUR 476

Anti-GSK3B antibody

STJ23879 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-GSK3B antibody

STJ23880 100 µl
EUR 277
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-GSK3B Antibody (Biotin)

STJ501296 100 µg
EUR 586

Anti-GSK3B Antibody (FITC)

STJ501297 100 µg
EUR 586

anti-GSK3B (3D10)

LF-MA30340 100 ul
EUR 486
Description: Mouse Monoclonal to GSK3B

Anti-GSK3b (Ab-9) Antibody

A00791-1 100ul
EUR 397
Description: Rabbit Polyclonal GSK3b (Ab-9) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-Phospho-GSK3B-(Y216) antibody

STJ110852 100 µl
EUR 393
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Phospho-GSK3B-(Y216) antibody

STJ116370 100 µl
EUR 393
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Phospho-GSK3B-(S9) antibody

STJ22160 100 µl
EUR 393
Description: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Hu-48T 48T
EUR 517
  • Should the Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Hu-96T 96T
EUR 673
  • Should the Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Mu-48T 48T
EUR 527
  • Should the Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Mu-96T 96T
EUR 688
  • Should the Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Ra-48T 48T
EUR 549
  • Should the Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

DLR-GSK3b-Ra-96T 96T
EUR 718
  • Should the Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glycogen Synthase Kinase 3 Beta (GSK3b) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Hu-48Tests 48 Tests
EUR 544

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Hu-96Tests 96 Tests
EUR 756

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Mu-48Tests 48 Tests
EUR 557

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Mu-96Tests 96 Tests
EUR 774

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Ra-48Tests 48 Tests
EUR 583

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RDR-GSK3b-Ra-96Tests 96 Tests
EUR 811

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Hu-48Tests 48 Tests
EUR 521

Human Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Hu-96Tests 96 Tests
EUR 723

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Mu-48Tests 48 Tests
EUR 533

Mouse Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Mu-96Tests 96 Tests
EUR 740

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Ra-48Tests 48 Tests
EUR 557

Rat Glycogen Synthase Kinase 3 Beta (GSK3b) ELISA Kit

RD-GSK3b-Ra-96Tests 96 Tests
EUR 775

GSK3B antibody

70R-17615 50 ul
EUR 435
Description: Rabbit polyclonal GSK3B antibody

GSK3b antibody

70R-11869 100 ug
EUR 418
Description: Rabbit polyclonal GSK3b antibody

GSK3B antibody

70R-15005 100 ul
EUR 392
Description: Rabbit polyclonal GSK3B antibody

GSK3B Antibody

36918-100ul 100ul
EUR 252

GSK3B antibody

38353-100ul 100ul
EUR 252

GSK3B antibody

38616-100ul 100ul
EUR 252

GSK3B antibody

10R-1862 100 ul
EUR 403
Description: Mouse monoclonal GSK3B antibody

GSK3B Antibody

1-CSB-PA002848
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/20000

GSK3B Antibody

1-CSB-PA080166
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

GSK3B Antibody

CSB-PA939628-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GSK3B Antibody

CSB-PA939628-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GSK3B Antibody

DF7231 200ul
EUR 304
Description: GSK3B Antibody detects endogenous levels of total GSK3B.

GSK3B Antibody

BF0695 200ul
EUR 376
Description: GSK3B antibody detects endogenous levels of total GSK3B.

GSK3B Antibody

1-CSB-PA009038
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

GSK3B Antibody

1-CSB-PA009963GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse, Rat, Pig. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GSK3B Antibody

1-CSB-PA009963LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:500

GSK3B Antibody

ABD6806 100 ug
EUR 438

GSK3B Antibody

ABD7231 100 ug
EUR 438

Phospho-GSK3b antibody

70R-11870 100 ug
EUR 525
Description: Rabbit polyclonal Phospho-GSK3b antibody

GSK3A/GSK3B Antibody

1-CSB-PA002838
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GSK3A/GSK3B. Recognizes GSK3A/GSK3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

GSK3B (pY216) Antibody

20-abx123289
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GSK3B Conjugated Antibody

C36918 100ul
EUR 397

GSK3B Conjugated Antibody

C38353 100ul
EUR 397

GSK3A / GSK3B Antibody

20-abx328487
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GSK3B Polyclonal Antibody

A62706 100 µg
EUR 570.55
Description: reagents widely cited

GSK3B (pY216) Antibody

20-abx000312
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

GSK3B siRNA

20-abx902344
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSK3B siRNA

20-abx918789
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSK3B siRNA

20-abx918790
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSK3B Plasmid

PVT7113 2 ug
EUR 266

Rabbit Anti-GSK3B monoclonal antibody, clone TZ13-82

DCABH-9320 100 ul
EUR 777

Rabbit Anti-Human GSK3B Polyclonal Antibody, Phospho-Tyr216

CPB-820RH 100 ul
EUR 559

Phospho-GSK3B (S9) Antibody

1-CSB-PA000536
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-GSK3B (S9). Recognizes Phospho-GSK3B (S9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/5000

Phospho-GSK3B (S9) Antibody

1-CSB-PA000636
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-GSK3B (S9). Recognizes Phospho-GSK3B (S9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GSK3B (Ab-9) Antibody

CSB-PA120951-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3B (Ab-9). Recognizes GSK3B (Ab-9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

GSK3B (Ab-9) Antibody

CSB-PA120951-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3B (Ab-9). Recognizes GSK3B (Ab-9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

Phospho-GSK3B (Ser9) Antibody

CSB-PA166926-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3B (Ser9). Recognizes Phospho-GSK3B (Ser9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-GSK3B (Ser9) Antibody

CSB-PA166926-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3B (Ser9). Recognizes Phospho-GSK3B (Ser9) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

GSK3B (pS21 / 29) Antibody

abx031864-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GSK3B (pS21 / 29) Antibody

abx031864-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GSK3B Polyclonal Conjugated Antibody

C30706 100ul
EUR 397

GSK3B Antibody, HRP conjugated

1-CSB-PA009963LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSK3B Antibody, FITC conjugated

1-CSB-PA009963LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSK3B Antibody, Biotin conjugated

1-CSB-PA009963LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSK3B. Recognizes GSK3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rabbit Anti-GSK3A, GSK3B monoclonal antibody, clone TZ37-16

CABT-L635 100 ul
EUR 777

Rabbit Anti-Human GSK3B (aa 214-218) Polyclonal Antibody

CPB-1178RH 100 ul
EUR 460

Anti-Glycogen synthase kinase 3 B (GSK3B) (Ser9) antibody

STJ120111 100 µl
EUR 526

[KO Validated] GSK3B Polyclonal Antibody

30706-100ul 100ul
EUR 252

[KO Validated] GSK3B Polyclonal Antibody

30706-50ul 50ul
EUR 187

GSK3A / GSK3B (pY279 / 216) Antibody

20-abx328488
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GSK3A / GSK3B (pY279 / 216) Antibody

abx333212-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Polyclonal GSK3B / GSK3 Beta Antibody

AMM05221G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSK3B / GSK3 Beta . This antibody is tested and proven to work in the following applications:

Monoclonal GSK3B Antibody, Clone: 3D6B4

AMM05223G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GSK3B. The antibodies are raised in Mouse and are from clone 3D6B4. This antibody is applicable in WB and IHC, FC, E

GSK3B Polyclonal Antibody, HRP Conjugated

A62707 100 µg
EUR 570.55
Description: Ask the seller for details

GSK3B Polyclonal Antibody, FITC Conjugated

A62708 100 µg
EUR 570.55
Description: The best epigenetics products

GSK3B Polyclonal Antibody, Biotin Conjugated

A62709 100 µg
EUR 570.55
Description: kits suitable for this type of research

Antibody for Human GSK3b (pSer9)

SPC-1384D 0.1ml
EUR 354
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is unconjugated.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A390 0.1ml
EUR 401
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 390.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A488 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 488.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A565 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 565.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A594 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 594.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A633 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 633.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A655 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 655.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A680 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 680.

Antibody for Human GSK3b (pSer9)

SPC-1384D-A700 0.1ml
EUR 400
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to ATTO 700.

Antibody for Human GSK3b (pSer9)

SPC-1384D-ALP 0.1ml
EUR 394
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human GSK3b (pSer9)

SPC-1384D-APC 0.1ml
EUR 399
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to APC .

Antibody for Human GSK3b (pSer9)

SPC-1384D-APCCY7 0.1ml
EUR 471
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to APC/Cy7.

Antibody for Human GSK3b (pSer9)

SPC-1384D-BI 0.1ml
EUR 396
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Biotin.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY350 0.1ml
EUR 414
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 350.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY405 0.1ml
EUR 403
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 405.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY488 0.1ml
EUR 393
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 488.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY594 0.1ml
EUR 395
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 594.

Antibody for Human GSK3b (pSer9)

SPC-1384D-DY633 0.1ml
EUR 390
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Dylight 633.

Antibody for Human GSK3b (pSer9)

SPC-1384D-FITC 0.1ml
EUR 392
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to FITC.

Antibody for Human GSK3b (pSer9)

SPC-1384D-HRP 0.1ml
EUR 388
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to HRP.

Antibody for Human GSK3b (pSer9)

SPC-1384D-P594 0.1ml
EUR 407
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to PE/ATTO 594.

Antibody for Human GSK3b (pSer9)

SPC-1384D-PCP 0.1ml
EUR 399
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to PerCP.

Antibody for Human GSK3b (pSer9)

SPC-1384D-RPE 0.1ml
EUR 397
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to RPE .

Antibody for Human GSK3b (pSer9)

SPC-1384D-STR 0.1ml
EUR 398
  • GSK3B a proline-directed protein kinase of the GSK family. Phosphorylates and inactivates glycogen synthase. Participates in the Wnt signaling pathway. Involved in energy metabolism, neuronal cell development, and body pattern formation .
Description: A polyclonal antibody for GSK3b (pSer9) from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic phospho-peptide from human GSK3b around the phosphorylation site of serine 9 (pSer9).. The Antibody is tested and validated for WB, IHC, IP assays with the following recommended dilutions: WB (1:250-1:1000); IHC (1:25-1:100); IP (Various dilutions). This GSK3b (pSer9) antibody is conjugated to Streptavidin.

GSK3B Rabbit mAb

A10877-100ul 100 ul
EUR 384

GSK3B Rabbit mAb

A10877-200ul 200 ul
EUR 554

GSK3B Rabbit mAb

A10877-20ul 20 ul Ask for price

GSK3B Rabbit mAb

A10877-50ul 50 ul
EUR 265

GSK3B Rabbit pAb

A11360-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A11360-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A11360-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A11360-50ul 50 ul
EUR 223

GSK3B Rabbit pAb

A11578-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A11578-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A11578-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A11578-50ul 50 ul
EUR 223

GSK3b Blocking Peptide

33R-10782 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSK3b antibody, catalog no. 70R-11869

GSK3B Blocking Peptide

DF7231-BP 1mg
EUR 195

GSK3B Blocking Peptide

BF0695-BP 1mg
EUR 195

GSK3B cloning plasmid

CSB-CL009963HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgtcagggcggcccagaaccacctcctttgcggagagctgcaagccggtgcagcagccttcagcttttggcagcatgaaagttagcagagacaaggacggcagcaaggtgacaacagtggtggcaactcctgggcagggtccagacaggccacaagaagtcagctatacagaca
  • Show more
Description: A cloning plasmid for the GSK3B gene.

GSK3B Rabbit pAb

A3174-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A3174-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A3174-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A3174-50ul 50 ul
EUR 223

GSK3B Rabbit pAb

A2081-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A2081-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A2081-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A2081-50ul 50 ul
EUR 223

GSK3B Rabbit pAb

A16868-100ul 100 ul
EUR 308

GSK3B Rabbit pAb

A16868-200ul 200 ul
EUR 459

GSK3B Rabbit pAb

A16868-20ul 20 ul
EUR 183

GSK3B Rabbit pAb

A16868-50ul 50 ul
EUR 223

Recombinant Human GSK3B

P0221 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P49841
Description: Recombinant Human protein for GSK3B

pT7- His- GSK3B

PVT10128 2 ug
EUR 301

Phospho-GSK3A/GSK3B (Y279/216) Antibody

1-CSB-PA000535
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-GSK3A/GSK3B (Y279/216). Recognizes Phospho-GSK3A/GSK3B (Y279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Polyclonal Mouse Gsk3b Antibody (N-term)

APR04027G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Gsk3b (N-term). This antibody is tested and proven to work in the following applications:

Phospho-GSK3A/GSK3B (Tyr279/216) Antibody

CSB-PA575559-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3A/GSK3B (Tyr279/216). Recognizes Phospho-GSK3A/GSK3B (Tyr279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-GSK3A/GSK3B (Tyr279/216) Antibody

CSB-PA575559-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-GSK3A/GSK3B (Tyr279/216). Recognizes Phospho-GSK3A/GSK3B (Tyr279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

GSK3A/GSK3B (Ab-279/216) Antibody

CSB-PA255909-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3A/GSK3B (Ab-279/216). Recognizes GSK3A/GSK3B (Ab-279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

GSK3A/GSK3B (Ab-279/216) Antibody

CSB-PA255909-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against GSK3A/GSK3B (Ab-279/216). Recognizes GSK3A/GSK3B (Ab-279/216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

GSK3A / GSK3B (Ab-279 / 216) Antibody

abx332166-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

GSK3B protein (His tag)

80R-3636 50 ug
EUR 435
Description: Purified recombinant GSK3B protein (His tag)

Human GSK3B ELISA Kit

ELA-E2298h 96 Tests
EUR 824

Mouse GSK3B shRNA Plasmid

20-abx974854
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GSK3B shRNA Plasmid

20-abx986899
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GSK3B shRNA Plasmid

20-abx951981
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV- 3*Flag- GSK3B

PVT10270 2 ug
EUR 301

pcDNA3.1-Myc-GSK3B Plasmid

PVTB01013-2a 2 ug
EUR 356

GSK3B Recombinant Protein (Human)

RP061362 100 ug Ask for price

GSK3B Recombinant Protein (Rat)

RP203810 100 ug Ask for price

GSK3B Recombinant Protein (Mouse)

RP140201 100 ug Ask for price

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx004714
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx224101-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx176674
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx176675
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx112808
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

20-abx121488
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx125048
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx125336
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

20-abx125917
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx037712-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase-3 Beta (GSK3B) Antibody

20-abx134166
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx147405-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx172635
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycogen Synthase Kinase 3 Beta (GSK3b) Antibody

20-abx172636
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycogen Synthase Kinase 3 Beta (GSK3B) Antibody

abx010856-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Toxicity on stem and progenitor cell subsets remained minimal. Mixed, our outcomes present a powerful rationale for mixture remedies utilizing the P70S6K inhibitor in MM. Direct and particular inhibition of P70S6K may present an answer for sufferers ineligible or insensitive to dexamethasone or different glucocorticoids.

Leave a Reply

Your email address will not be published. Required fields are marked *