medmk

A framework for highly multiplexed dextramer mapping

A framework for extremely multiplexed dextramer mapping and prediction of T cell receptor sequences to antigen specificity

T cell receptor (TCR) antigen-specific recognition is important for the adaptive immune system. Nonetheless, constructing a TCR-antigen interplay map has been difficult because of the staggering range of TCRs and antigens. Accordingly, extremely multiplexed dextramer-TCR binding assays have been lately developed, however the utility of the following giant datasets is proscribed by the dearth of strong computational strategies for normalization and interpretation.

Right here, we current a computational framework comprising a novel technique, ICON (Integrative COntext-specific Normalization), for figuring out dependable TCR-pMHC (peptide-major histocompatibility complicated) interactions and a neural network-based classifier TCRAI that outperforms different state-of-the-art strategies for TCR-antigen specificity prediction. We additional demonstrated that by combining ICON and TCRAI, we’re in a position to uncover novel subgroups of TCRs that bind to a given pMHC through completely different mechanisms. Our framework facilitates the identification and understanding of TCR-antigen-specific interactions for fundamental immunological analysis and scientific immune monitoring.

medmk
medmk
CORNING® REUSABLE PHENOLIC GPI 28-400 THREADED SCREW CAP WITH RUBBER LINER
9999-28 144/pk
EUR 240
Description: General Apparatus; Stoppers
Mouse pre-microRNA Expression Construct mir-28
MMIR-28-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools
EBAG9 antibody
70R-16981 50 ul
EUR 435
Description: Rabbit polyclonal EBAG9 antibody
EBAG9 antibody
38323-100ul 100ul
EUR 252
EBAG9 Antibody
DF6703 200ul
EUR 304
Description: EBAG9 Antibody detects endogenous levels of total EBAG9.
EBAG9 antibody
70R-9916 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EBAG9 antibody
EBAG9 Antibody
1-CSB-PA007355GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EBAG9. Recognizes EBAG9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
EBAG9 siRNA
20-abx901624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 siRNA
20-abx914879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 siRNA
20-abx914880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 Antibody
ABD6703 100 ug
EUR 438
EBAG9 protein (His tag)
80R-1093 100 ug
EUR 224
Description: Purified recombinant Human EBAG9 protein
CMV (Cytomegalovirus Antibody IgG) ELISA test
28 96T/Box Ask for price
  • Area of application: Prepotency testing
Description: ELISA based test for quantitative detection of CMV (Cytomegalovirus Antibody IgG)
RNU6-28 Recombinant Protein (Human)
RP089073 100 ug Ask for price
Recombinant HPV-28 E1 Protein
VAng-Wyb3131-inquire inquire Ask for price
Description: Human papillomavirus type 28 Replication protein E1, recombinant protein.
Recombinant HPV-28 L1 Protein
VAng-Wyb3136-inquire inquire Ask for price
Description: Human papillomavirus type 28 Major capsid protein L1, recombinant protein.
EBAG9 Blocking Peptide
33R-2039 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EBAG9 antibody, catalog no. 70R-9916
Human EBAG9 Antibody
32605-05111 150 ug
EUR 261
EBAG9 Blocking Peptide
DF6703-BP 1mg
EUR 195
EBAG9 Conjugated Antibody
C38323 100ul
EUR 397
EBAG9 cloning plasmid
CSB-CL007355HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.
EBAG9 cloning plasmid
CSB-CL007355HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.
EBAG9 Rabbit pAb
A8385-100ul 100 ul
EUR 308
EBAG9 Rabbit pAb
A8385-200ul 200 ul
EUR 459
EBAG9 Rabbit pAb
A8385-20ul 20 ul Ask for price
EBAG9 Rabbit pAb
A8385-50ul 50 ul Ask for price
EBAG9 Rabbit pAb
A1935-100ul 100 ul
EUR 308
EBAG9 Rabbit pAb
A1935-200ul 200 ul
EUR 459
EBAG9 Rabbit pAb
A1935-20ul 20 ul
EUR 183
EBAG9 Rabbit pAb
A1935-50ul 50 ul
EUR 223
Anti-EBAG9 Antibody
PB9553 100ug/vial
EUR 334
pCMV-SPORT6-EBAG9
PVT13493 2 ug
EUR 391
Anti-EBAG9 antibody
STJ110683 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.
Anti-EBAG9 antibody
STJ23462 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.
Anti-EBAG9 (4A10)
YF-MA16699 100 ug
EUR 363
Description: Mouse monoclonal to EBAG9
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-100ug
QP5959-ec-100ug 100ug
EUR 408
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-10ug
QP5959-ec-10ug 10ug
EUR 200
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-1mg
QP5959-ec-1mg 1mg
EUR 1632
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-200ug
QP5959-ec-200ug 200ug
EUR 634
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-500ug
QP5959-ec-500ug 500ug
EUR 1060
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-50ug
QP5959-ec-50ug 50ug
EUR 263
IL-28, human recombinant
4978-1000
EUR 5204
IL-28, human recombinant
4978-20
EUR 294
Matrix Metalloproteinase-28 (Recombinant)
20-abx073425
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Recombinant Keratin 28 (KRT28)
4-RPS214Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A6BLY7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 80.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Keratin 28 expressed in: E.coli
Recombinant Human Vacuolar Protein Sorting 28
7-06871 10µg Ask for price
Recombinant Human Vacuolar Protein Sorting 28
7-06872 50µg Ask for price
Recombinant Human Vacuolar Protein Sorting 28
7-06873 1mg Ask for price
Polyclonal EBAG9 Antibody (Center)
APR04492G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:
Rat EBAG9 shRNA Plasmid
20-abx989010
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse EBAG9 shRNA Plasmid
20-abx974569
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Polyclonal EBAG9 Antibody (Center)
APR06938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:
Human EBAG9 shRNA Plasmid
20-abx956064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-EBAG9 / RCAS1 antibody
STJ70947 100 µg
EUR 359
PRSS28 Protease Serine 28 Mouse Recombinant Protein
PROTQ924N9 Regular: 5ug
EUR 317
Description: PRSS28 Mouse Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 256 amino acids (27-274a.a.) and having a molecular mass of 28.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa)._x000D_PRSS28 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
MMP28 Matrix Metalloproteinase-28 Human Recombinant Protein
PROTQ9H239 Regular: 20ug
EUR 317
Description: MMP28 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 421 amino acids (123-520a.a) and having a molecular mass of 47.3kDa. MMP28 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-100g 100 µg
EUR 1013
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)
Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-1mg 1 mg
EUR 6402
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)
Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-20g 20 µg
EUR 594
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)
Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-50g 50 µg
EUR 1013
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-1mgEcoli 1 mg (E. coli)
EUR 2577
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-500gEcoli 500 µg (E. coli)
EUR 1747
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-50gEcoli 50 µg (E. coli)
EUR 1197
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-100g 100 µg
EUR 7254
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)
Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-50g 50 µg
EUR 4765
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-100g 100 µg
EUR 1150
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-1mg 1 mg
EUR 3913
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-500g 500 µg
EUR 2663
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-1mg 1 mg
EUR 3390
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-200g 200 µg
EUR 1370
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-500g 500 µg
EUR 2223
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-1mg 1 mg
EUR 5852
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)
Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-500g 500 µg
EUR 3583
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)
Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-500g 500 µg
EUR 6415
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)
Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-50g 50 µg
EUR 1246
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)
VPS28 Vacuolar Protein Sorting 28 Human Recombinant Protein
PROTQ9UK41 Regular: 50ug
EUR 317
Description: VPS28 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-221 a.a.) and having a molecular mass of 25.4kDa.;The VPS28 is purified by proprietary chromatographic techniques.
EBAG9 Protein Vector (Mouse) (pPB-C-His)
PV174238 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPB-N-His)
PV174239 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPM-C-HA)
PV174240 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPM-C-His)
PV174241 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPB-C-His)
PV265294 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPB-N-His)
PV265295 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPM-C-HA)
PV265296 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPM-C-His)
PV265297 500 ng
EUR 603
EBAG9 Protein Vector (Human) (pPB-C-His)
PV013461 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-N-His)
PV013462 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013463 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-His)
PV013464 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-C-His)
PV013465 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-N-His)
PV013466 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013467 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-His)
PV013468 500 ng
EUR 329
Human EBAG9 Antibody (Biotin Conjugate)
32605-05121 150 ug
EUR 369
Ebag9 ORF Vector (Rat) (pORF)
ORF066324 1.0 ug DNA
EUR 506
EBAG9 ORF Vector (Human) (pORF)
ORF003366 1.0 ug DNA
EUR 95
EBAG9 ORF Vector (Human) (pORF)
ORF003367 1.0 ug DNA
EUR 95
Ebag9 ORF Vector (Mouse) (pORF)
ORF043560 1.0 ug DNA
EUR 506
EBAG9 ELISA Kit (Human) (OKCA02302)
OKCA02302 96 Wells
EUR 930
Description: Description of target: May participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.195 U/mL.
EBAG9 ELISA Kit (Human) (OKEH05822)
OKEH05822 96 Wells
EUR 662
Description: Description of target: May participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39U/L
TRIM28 Tripartite Motif Containing 28 Human Recombinant Protein
PROTQ13263 Regular: 20ug
EUR 317
Description: TRIM28 Human Recombinant produced in E. Coli is a single polypeptide chain containing 460 amino acids (366-802) and having a molecular mass of 48.7 kDa.;TRIM28 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Recombinant ALCAM Protein (Trp 28-Ala 526) [Fc]
VAng-0714Lsx-1mg 1 mg
EUR 2745
Description: Human ALCAM, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001618)
Recombinant ALCAM Protein (Trp 28-Ala 526) [Fc]
VAng-0714Lsx-200g 200 µg
EUR 793
Description: Human ALCAM, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001618)
Recombinant ALCAM Protein (Trp 28-Ala 526) [His]
VAng-0715Lsx-1mg 1 mg
EUR 2580
Description: Human ALCAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q13740-1)
Recombinant ALCAM Protein (Trp 28-Ala 526) [His]
VAng-0715Lsx-200g 200 µg
EUR 738
Description: Human ALCAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q13740-1)
Recombinant CD31 Protein (Gln 28-Lys 601) [Fc]
VAng-1265Lsx-1mg 1 mg
EUR 4009
Description: Human CD31, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: AAH22512.1)
Recombinant CD31 Protein (Gln 28-Lys 601) [Fc]
VAng-1265Lsx-200g 200 µg
EUR 985
Description: Human CD31, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: AAH22512.1)
Recombinant CD31 Protein (Gln 28-Lys 601) [His]
VAng-1266Lsx-100g 100 µg
EUR 738
Description: Human CD31, His tag, is expressed in HEK 293 cells. (Uniprot ID: P16284-1)
Recombinant CD31 Protein (Gln 28-Lys 601) [His]
VAng-1266Lsx-1mg 1 mg
EUR 4009
Description: Human CD31, His tag, is expressed in HEK 293 cells. (Uniprot ID: P16284-1)
Recombinant CNDP1 Protein (Ser 28-His 508) [His]
VAng-1408Lsx-1mg 1 mg
EUR 5274
Description: Human CNDP1, His tag, is expressed in HEK 293 cells. (Uniprot ID: AAI17123)
Recombinant CNDP1 Protein (Ser 28-His 508) [His]
VAng-1408Lsx-50g 50 µg
EUR 848
Description: Human CNDP1, His tag, is expressed in HEK 293 cells. (Uniprot ID: AAI17123)
Recombinant ErbB3 Protein (Leu 28-Gly 232) [His]
VAng-1507Lsx-200g 200 µg
EUR 3844
Description: Human ErbB3 (Her3), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)
Recombinant ErbB3 Protein (Leu 28-Gly 232) [His]
VAng-1507Lsx-25g 25 µg
EUR 1013
Description: Human ErbB3 (Her3), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)
Recombinant Staphylococcus Aureus entB Protein (aa 28-266)
VAng-Cr5729-1mgEcoli 1 mg (E. coli)
EUR 4793
Description: Staphylococcus Aureus Enterotoxin type B (entB), recombinant protein.
Recombinant Staphylococcus Aureus entB Protein (aa 28-266)
VAng-Cr5729-500gEcoli 500 µg (E. coli)
EUR 3048
Description: Staphylococcus Aureus Enterotoxin type B (entB), recombinant protein.
Recombinant Staphylococcus Aureus ENTC1 Protein (aa 28-266)
VAng-Cr5730-inquire inquire Ask for price
Description: Staphylococcus Aureus Enterotoxin type C-1 (ENTC1), recombinant protein.
Recombinant Staphylococcus Aureus entC2 Protein (aa 28-266)
VAng-Cr5731-500gEcoli 500 µg (E. coli)
EUR 2663
Description: Staphylococcus Aureus Enterotoxin type C-2 (entC2), recombinant protein.
Recombinant Staphylococcus Aureus entC2 Protein (aa 28-266)
VAng-Cr5731-50gEcoli 50 µg (E. coli)
EUR 1810
Description: Staphylococcus Aureus Enterotoxin type C-2 (entC2), recombinant protein.
Recombinant Staphylococcus Aureus entE Protein (aa 28-257)
VAng-Cr5733-inquire inquire Ask for price
Description: Staphylococcus Aureus Enterotoxin type E (entE), recombinant protein.
Recombinant Staphylococcus Aureus ssaA2 Protein (aa 28-267)
VAng-Cr6465-inquire inquire Ask for price
Description: Staphylococcus Aureus (strain Mu50 / ATCC 700699) Staphylococcal secretory antigen ssaA2 (ssaA2), recombinant protein.
Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-1mgEcoli 1 mg (E. coli)
EUR 3473
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.
Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-500gEcoli 500 µg (E. coli)
EUR 2484
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.
Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-50gEcoli 50 µg (E. coli)
EUR 1686
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.
Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-1mgEcoli 1 mg (E. coli)
EUR 2814
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.
Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-500gEcoli 500 µg (E. coli)
EUR 2016
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.
Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-50gEcoli 50 µg (E. coli)
EUR 1398
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.
Recombinant Trypanosoma Brucei PROA Protein (aa 28-93)
VAng-Wyb8152-1mgEcoli 1 mg (E. coli)
EUR 2649
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide protein, recombinant protein.
Recombinant Trypanosoma Brucei PROA Protein (aa 28-93)
VAng-Wyb8152-500gEcoli 500 µg (E. coli)
EUR 1879
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide protein, recombinant protein.
Recombinant Trypanosoma Brucei PROA Protein (aa 28-93)
VAng-Wyb8152-50gEcoli 50 µg (E. coli)
EUR 1301
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide protein, recombinant protein.
Recombinant Mycobacterium Bovis Mb2034c Protein (aa 28-143)
VAng-Yyj2888-1mgEcoli 1 mg (E. coli)
EUR 2940
Description: Mycobacterium Bovis Uncharacterized protein Mb2034c (Mb2034c), recombinant protein.
Recombinant Mycobacterium Bovis Mb2034c Protein (aa 28-143)
VAng-Yyj2888-500gEcoli 500 µg (E. coli)
EUR 2109
Description: Mycobacterium Bovis Uncharacterized protein Mb2034c (Mb2034c), recombinant protein.
Recombinant Mycobacterium Bovis Mb2034c Protein (aa 28-143)
VAng-Yyj2888-50gEcoli 50 µg (E. coli)
EUR 1454
Description: Mycobacterium Bovis Uncharacterized protein Mb2034c (Mb2034c), recombinant protein.
Recombinant Mycobacterium Bovis Mb1845 Protein (aa 28-221)
VAng-Yyj3040-1mgEcoli 1 mg (E. coli)
EUR 3432
Description: Mycobacterium Bovis Uncharacterized protein Mb1845 (Mb1845), recombinant protein.
Recombinant Mycobacterium Bovis Mb1845 Protein (aa 28-221)
VAng-Yyj3040-500gEcoli 500 µg (E. coli)
EUR 2456
Description: Mycobacterium Bovis Uncharacterized protein Mb1845 (Mb1845), recombinant protein.
Recombinant Mycobacterium Bovis Mb1845 Protein (aa 28-221)
VAng-Yyj3040-50gEcoli 50 µg (E. coli)
EUR 1673
Description: Mycobacterium Bovis Uncharacterized protein Mb1845 (Mb1845), recombinant protein.
Recombinant Mycobacterium Bovis Mb3815c Protein (aa 28-407)
VAng-Yyj3128-1mgEcoli 1 mg (E. coli)
EUR 4614
Description: Mycobacterium Bovis Uncharacterized protein Mb3815c (Mb3815c), recombinant protein.
Recombinant Mycobacterium Bovis Mb3815c Protein (aa 28-407)
VAng-Yyj3128-500gEcoli 500 µg (E. coli)
EUR 3268
Description: Mycobacterium Bovis Uncharacterized protein Mb3815c (Mb3815c), recombinant protein.
Recombinant Mycobacterium Bovis Mb3815c Protein (aa 28-407)
VAng-Yyj3128-50gEcoli 50 µg (E. coli)
EUR 2236
Description: Mycobacterium Bovis Uncharacterized protein Mb3815c (Mb3815c), recombinant protein.
Recombinant Caenorhabditis Elegans F01G4.6 Protein (aa 28-340)
VAng-Ly3313-inquire inquire Ask for price
Description: Caenorhabditis Elegans phosphate carrier protein, mitochondrial (F01G4.6), recombination protein.
Recombinant Mycobacterium Leprae lprB Protein (aa 28-188)
VAng-Yyj1725-50gEcoli 50 µg (E. coli)
EUR 1594
Description: Mycobacterium Leprae Putative lipoprotein lprB (lprB), recombinant protein.
Recombinant Mycobacterium Tuberculosis Rv2011c Protein (aa 28-143)
VAng-Yyj0692-50gEcoli 50 µg (E. coli)
EUR 1454
Description: Mycobacterium Tuberculosis Uncharacterized protein Rv2011c/MT2066 (Rv2011c, MT2066), recombinant protein.
Recombinant Mycobacterium Tuberculosis Rv3786c Protein (aa 28-407)
VAng-Yyj0754-50gEcoli 50 µg (E. coli)
EUR 2238
Description: Mycobacterium Tuberculosis Uncharacterized protein Rv3786c/MT3894 (Rv3786c, MT3894), recombinant protein.
Recombinant HPV-28 E2 (aa 1-376) Protein
VAng-Wyb3132-1mgEcoli 1 mg (E. coli)
EUR 4587
Description: Human papillomavirus type 28 Regulatory protein E2, recombinant protein.
Recombinant HPV-28 E2 (aa 1-376) Protein
VAng-Wyb3132-500gEcoli 500 µg (E. coli)
EUR 3239
Description: Human papillomavirus type 28 Regulatory protein E2, recombinant protein.
Recombinant HPV-28 E2 (aa 1-376) Protein
VAng-Wyb3132-50gEcoli 50 µg (E. coli)
EUR 2209
Description: Human papillomavirus type 28 Regulatory protein E2, recombinant protein.
Recombinant HPV-28 E4 (aa 1-99) Protein
VAng-Wyb3133-1mgEcoli 1 mg (E. coli)
EUR 2840
Description: Human papillomavirus type 28 Probable protein E4, recombinant protein.
Recombinant HPV-28 E4 (aa 1-99) Protein
VAng-Wyb3133-500gEcoli 500 µg (E. coli)
EUR 2030
Description: Human papillomavirus type 28 Probable protein E4, recombinant protein.
Recombinant HPV-28 E4 (aa 1-99) Protein
VAng-Wyb3133-50gEcoli 50 µg (E. coli)
EUR 1398
Description: Human papillomavirus type 28 Probable protein E4, recombinant protein.
Recombinant HPV-28 E6 (aa 1-146) Protein
VAng-Wyb3134-1mgEcoli 1 mg (E. coli)
EUR 3129
Description: Human papillomavirus type 28 protein E6, recombinant protein.
Recombinant HPV-28 E6 (aa 1-146) Protein
VAng-Wyb3134-500gEcoli 500 µg (E. coli)
EUR 2236
Description: Human papillomavirus type 28 protein E6, recombinant protein.
Recombinant HPV-28 E6 (aa 1-146) Protein
VAng-Wyb3134-50gEcoli 50 µg (E. coli)
EUR 1549
Description: Human papillomavirus type 28 protein E6, recombinant protein.
Recombinant HPV-28 E7 (aa 1-87) Protein
VAng-Wyb3135-1mgEcoli 1 mg (E. coli)
EUR 2785
Description: Human papillomavirus type 28 protein E7, recombinant protein.
Recombinant HPV-28 E7 (aa 1-87) Protein
VAng-Wyb3135-500gEcoli 500 µg (E. coli)
EUR 1975
Description: Human papillomavirus type 28 protein E7, recombinant protein.
Recombinant HPV-28 E7 (aa 1-87) Protein
VAng-Wyb3135-50gEcoli 50 µg (E. coli)
EUR 1370
Description: Human papillomavirus type 28 protein E7, recombinant protein.
Recombinant HPV-28 L2 (aa 1-473) Protein
VAng-Wyb3137-1mgEcoli 1 mg (E. coli)
EUR 5205
Description: Human papillomavirus type 28 Minor capsid protein L2, recombinant protein.
Recombinant HPV-28 L2 (aa 1-473) Protein
VAng-Wyb3137-500gEcoli 500 µg (E. coli)
EUR 3679
Description: Human papillomavirus type 28 Minor capsid protein L2, recombinant protein.
Recombinant HPV-28 L2 (aa 1-473) Protein
VAng-Wyb3137-50gEcoli 50 µg (E. coli)
EUR 2511
Description: Human papillomavirus type 28 Minor capsid protein L2, recombinant protein.
Recombinant Aeromonas Hydrophila dnsH Protein (aa 28-237)
VAng-Lsx0622-1mgEcoli 1 mg (E. coli)
EUR 3736
Description: Aeromonas Hydrophila Periplasmic deoxyribonuclease (aa 28-237), recombinant protein.
Recombinant Aeromonas Hydrophila dnsH Protein (aa 28-237)
VAng-Lsx0622-500gEcoli 500 µg (E. coli)
EUR 2530
Description: Aeromonas Hydrophila Periplasmic deoxyribonuclease (aa 28-237), recombinant protein.
Recombinant Aeromonas Hydrophila dnsH Protein (aa 28-237)
VAng-Lsx0622-50gEcoli 50 µg (E. coli)
EUR 1723
Description: Aeromonas Hydrophila Periplasmic deoxyribonuclease (aa 28-237), recombinant protein.
Recombinant Aeromonas Hydrophila cphA Protein (aa 28-254)
VAng-Lsx0640-1mgEcoli 1 mg (E. coli)
EUR 3829
Description: Aeromonas Hydrophila Aeromonas Hydrophila Beta-lactamase (aa 28-254), recombinant protein.

Quantifying persistence within the T-cell signaling community utilizing an optically controllable antigen receptor

T cells discriminate between wholesome and contaminated cells with outstanding sensitivity when mounting an immune response, which is hypothesized to rely upon T cells combining stimuli from a number of antigen-presenting cell interactions right into a stronger response. To quantify the capability for T cells to perform this, now we have developed an antigen receptor that’s optically tunable inside cell conjugates, offering management over the period, and depth of intracellular T-cell signaling.

We observe restricted persistence throughout the T-cell intracellular community on disruption of receptor enter, with alerts dissipating completely in ~15 min, and straight present sustained proximal receptor signaling is required to keep up gene transcription. T cells thus primarily accumulate the outputs of gene expression slightly than combine discrete intracellular alerts. Engineering optical management in a clinically related chimeric antigen receptor (CAR), we present that this restricted sign persistence might be exploited to extend CAR-T cell activation threefold utilizing pulsatile stimulation. Our outcomes are prone to apply extra typically to the signaling dynamics of different mobile networks.

Tumor rejection properties of gp100 209-specific T cells correlate with T cell receptor binding affinity in the direction of the wild kind slightly than anchor-modified antigen

Though there are exceptions and outliers, T cell practical responses typically correlate with the affinity of a TCR for a peptide/MHC complicated. In a single lately described outlier case, probably the most promising scientific candidate in a collection of TCRs particular for the gp100209 melanoma antigen sure with the weakest answer affinity and produced the least quantity of cytokine in vitro. Hypotheses for this outlier habits included uncommon cytokine expression patterns arising from an atypical TCR binding geometry. Finding out this occasion in additional element, we discovered right here that outlier habits is attributable to not uncommon cytokine patterns or TCR binding, however using a place 2 anchor-modified peptide variant in in vitro experiments as a substitute of the wild kind antigen that’s current in vivo.

Though the anchor-modified variant has been extensively utilized in fundamental and scientific immunology as a surrogate for the wild kind peptide, prior work has proven that TCRs can clearly distinguish between the 2. We present that when this differential recognition is accounted for, the practical properties of gp100209-specific TCRs monitor with their affinity in the direction of the peptide/MHC complicated. Past demonstrating the correlates with T cell operate for a clinically related TCR, our outcomes present vital concerns for collection of TCRs for immunotherapy and using modified peptides in immunology.

Proliferating cell nuclear antigen straight interacts with androgen receptor and enhances androgen receptor‑mediated signaling

Androgen receptor (AR) and/or its constitutively lively splicing variants (AR‑Vs), resembling AR‑V7 and ARv567es, is required for prostate most cancers cell development and survival, and most cancers development. Proliferating cell nuclear antigen (PCNA) is preferentially overexpressed in all cancers and executes its features by interplay with quite a few accomplice proteins. The intention of the current research was to analyze the potential position of PCNA within the regulation of AR exercise.

An an identical consensus sequence of the PCNA‑interacting protein‑field (PIP‑field) was recognized on the N‑terminus of human, mouse and rat AR proteins. It was discovered that PCNA complexes with the total‑size AR (AR‑FL) and AR‑V7, which might be attenuated by the small molecule PIP‑field inhibitor, T2AA. PCNA additionally complexes with ARv567es and recombinant AR protein. The PCNA inhibitors, PCNA‑I1S and T2AA, inhibited AR transcriptional exercise and the expression of AR goal genes in LNCaP‑AI and 22Rv1 cells, however not in AR‑unfavorable PC‑three cells. The knockdown of PCNA expression lowered dihydrotestosterone‑stimulated AR transcriptional exercise and abolished the inhibitory impact of PCNA‑I1S on AR exercise. The PCNA inhibitor, PCNA‑I1, exerted additive development inhibitory results with androgen deprivation and enzalutamide in cells expressing AR‑FL or AR‑FL/AR‑V7, however not in AR‑unfavorable PC‑three cells.

Lastly, R9‑AR‑PIP, a small peptide mimicking AR PIP‑field, was discovered to bind to GFP‑PCNA at Okayd of two.73 µM and inhibit the expression of AR goal genes, AR transcriptional exercise and the expansion of AR‑expressing cells. On the entire, these information strongly counsel that AR is a PCNA accomplice protein and interacts with PCNA through the PIP‑field and that concentrating on the PCNA‑AR interplay could signify an revolutionary and selective therapeutic technique towards prostate most cancers, significantly castration‑resistant prostate cancers overexpressing constitutively lively AR‑Vs.

Novel high-affinity EGFRvIII-specific chimeric antigen receptor T cells successfully remove human glioblastoma

Aims: The growing success of Chimeric Antigen Receptor (CAR) T cell remedy in haematological malignancies is reinvigorating its utility in lots of different most cancers sorts and with renewed deal with its utility to stable tumors. We current a novel CAR towards glioblastoma, an aggressive, malignant glioma, with a dismal survival charge for which remedy choices have remained unchanged for over a decade.

Strategies: We use the human Retained Show (ReD) antibody platform (Myrio Therapeutics) to determine a novel single-chain variable fragment (scFv) that recognises epidermal development issue receptor mutant variant III (EGFRvIII), a typical and tumor-specific mutation present in glioblastoma. We use each in vitro practical assays and an in vivo orthotopic xenograft mannequin of glioblastoma to look at the operate of our novel CAR, known as GCT02, focused utilizing murine CAR T cells.

Outcomes: Our EGFRvIII-specific scFv was discovered to be of a lot increased affinity than reported comparators reverse-engineered from monoclonal antibodies. Regardless of the upper affinity, GCT02 CAR T cells kill equivalently however secrete decrease quantities of cytokine. As well as, GCT02-CAR T cells additionally mediate fast and full tumor elimination in vivo.

Conclusion: We current a novel EGFRvIII-specific CAR, with efficient antitumor features each in in vitro and in a xenograft mannequin of human glioblastoma.

RNY1P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746871 1.0 ug DNA Ask for price

RNY1P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746877 1.0 ug DNA Ask for price

RNY1P6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746883 1.0 ug DNA Ask for price

RNY1P7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746889 1.0 ug DNA Ask for price

RNY1P8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746895 1.0 ug DNA Ask for price

RNY3P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746901 1.0 ug DNA Ask for price

RNY3P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746907 1.0 ug DNA Ask for price

RNY3P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746913 1.0 ug DNA Ask for price

RNY3P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746919 1.0 ug DNA Ask for price

RNY3P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746925 1.0 ug DNA Ask for price

RNY3P6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746931 1.0 ug DNA Ask for price

RNY3P7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746937 1.0 ug DNA Ask for price

RNY3P8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746943 1.0 ug DNA Ask for price

RNY3P9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746949 1.0 ug DNA Ask for price

RNY3P10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746955 1.0 ug DNA Ask for price

RNY4P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746961 1.0 ug DNA Ask for price

RNY4P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746967 1.0 ug DNA Ask for price

RNY4P6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746973 1.0 ug DNA Ask for price

RNY4P7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746979 1.0 ug DNA Ask for price

RNY4P9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746985 1.0 ug DNA Ask for price

RNY4P10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746991 1.0 ug DNA Ask for price

RNY4P11 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV746997 1.0 ug DNA Ask for price

RNY4P12 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747003 1.0 ug DNA Ask for price

RNY4P13 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747009 1.0 ug DNA Ask for price

RNY4P14 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747015 1.0 ug DNA Ask for price

RNY4P15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747021 1.0 ug DNA Ask for price

RNY4P16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747027 1.0 ug DNA Ask for price

RNY4P17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747033 1.0 ug DNA Ask for price

RNY4P18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747039 1.0 ug DNA Ask for price

RNY4P19 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747045 1.0 ug DNA Ask for price

RNY4P20 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747051 1.0 ug DNA Ask for price

RNY4P21 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747057 1.0 ug DNA Ask for price

RNY4P22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747063 1.0 ug DNA Ask for price

RNY4P23 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747069 1.0 ug DNA Ask for price

RNY4P24 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747075 1.0 ug DNA Ask for price

RNY4P25 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747081 1.0 ug DNA Ask for price

RNY4P26 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747087 1.0 ug DNA Ask for price

RNY4P27 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747093 1.0 ug DNA Ask for price

RNY4P28 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747099 1.0 ug DNA Ask for price

RNY4P29 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747105 1.0 ug DNA Ask for price

RNY4P30 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747111 1.0 ug DNA Ask for price

RNY4P31 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747117 1.0 ug DNA Ask for price

RNY5P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747123 1.0 ug DNA Ask for price

RNY5P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747129 1.0 ug DNA Ask for price

RNY5P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747135 1.0 ug DNA Ask for price

RNY5P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747141 1.0 ug DNA Ask for price

RNY5P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747147 1.0 ug DNA Ask for price

RNY5P6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747153 1.0 ug DNA Ask for price

RNY5P7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747159 1.0 ug DNA Ask for price

RNY5P8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747165 1.0 ug DNA Ask for price

RNY5P9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747171 1.0 ug DNA Ask for price

RNY5P10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747177 1.0 ug DNA Ask for price

RP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747189 1.0 ug DNA Ask for price

RP22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747195 1.0 ug DNA Ask for price

RP23 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747201 1.0 ug DNA Ask for price

RP24 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747207 1.0 ug DNA Ask for price

RP29 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747213 1.0 ug DNA Ask for price

RP32 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747219 1.0 ug DNA Ask for price

RP34 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747225 1.0 ug DNA Ask for price

RP52 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747231 1.0 ug DNA Ask for price

RPA2P Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747237 1.0 ug DNA Ask for price

RPF2P Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747243 1.0 ug DNA Ask for price

RPIAP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747249 1.0 ug DNA Ask for price

RPL3P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747255 1.0 ug DNA Ask for price

RPL5P31 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747261 1.0 ug DNA Ask for price

RPL7AP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747267 1.0 ug DNA Ask for price

RPL7AP73 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747273 1.0 ug DNA Ask for price

RPL7L1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747279 1.0 ug DNA Ask for price

RPL7L1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747285 1.0 ug DNA Ask for price

RPL7L1P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747291 1.0 ug DNA Ask for price

RPL7L1P10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747297 1.0 ug DNA Ask for price

RPL7L1P12 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747303 1.0 ug DNA Ask for price

RPL7P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747309 1.0 ug DNA Ask for price

RPL7P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747315 1.0 ug DNA Ask for price

RPL8P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747321 1.0 ug DNA Ask for price

RPL8P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747327 1.0 ug DNA Ask for price

RPL10P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747333 1.0 ug DNA Ask for price

RPL17P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747339 1.0 ug DNA Ask for price

RPL18AP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747345 1.0 ug DNA Ask for price

RPL18AP17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747351 1.0 ug DNA Ask for price

RPL21P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747357 1.0 ug DNA Ask for price

RPL21P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747363 1.0 ug DNA Ask for price

RPL21P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747369 1.0 ug DNA Ask for price

RPL21P7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747375 1.0 ug DNA Ask for price

RPL21P9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747381 1.0 ug DNA Ask for price

RPL21P12 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747387 1.0 ug DNA Ask for price

RPL26P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747393 1.0 ug DNA Ask for price

RPL27AP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747399 1.0 ug DNA Ask for price

RPL31P9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747405 1.0 ug DNA Ask for price

RPL34P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV747411 1.0 ug DNA Ask for price

Leave a Reply

Your email address will not be published. Required fields are marked *