Validation of a monoclonal antibody directed against the human sphingosine 1-phosphate receptor type 1

Validation of a monoclonal antibody directed against the human sphingosine 1-phosphate receptor type 1

The sphingosine 1-phosphate receptor kind 1 (S1PR1) has a number of vital features, together with stabilizing endothelial barrier and sustaining lymphocyte circulation. These features are critically depending on the regulation of S1PR1 cell floor expression. Presently obtainable antibodies in opposition to human S1PR1 are usually not in a position to decide up cell floor expression on residing cells by movement cytometry as a consequence of intracellular epitopes or unspecific binding.

Right here we describe the era of a mouse monoclonal antibody particular for the N-terminal area of human S1PR1. It has an immunoglobulin M (IgM) kappa isotype and detects cell floor expression of recombinant human S1PR1 on overexpressing cells. As a consequence of unspecific intracellular cell staining, it can’t be used for staining of useless cells and tissue slides or in microscopic analyses.

It’s also not appropriate for Western blot evaluation and immunoprecipitation. Nonetheless, the antibody can stain for endogenous S1PR1 on human endothelial cell traces and first human umbilical vein endothelial cells (HUVEC). Incubation of those cells with numerous S1PR1 agonists revealed potent S1PR1 internalization, which was not the case with the particular antagonist W146.

Surprisingly, human T and B cells remoted from blood and palatine tonsils didn’t present particular staining, demonstrating considerably decrease endogenous S1PR1 floor expression on lymphocytes than on endothelial cells.

Sphingosine-1-phosphate receptor modulator FTY720 attenuates experimental myeloperoxidase-ANCA vasculitis in a T cell-dependent method

Sphingosine-1-phosphate (S1P) is a pleiotropic lysosphingolipid derived from the metabolism of plasma membrane lipids. The interplay between S1P and its ubiquitously expressed G-protein-coupled receptors (S1PR1-5) is essential in lots of pathophysiological processes. Rising proof recommended a possible position for S1P receptors in anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV).
Within the current research, we investigated the consequences of three totally different S1P receptors modulators in a acknowledged rat mannequin of experimental autoimmune vasculitis (EAV). The consequences of therapies had been evaluated with clinico-pathological parameters together with hematuria, proteinuria, crescent formation, pulmonary hemorrhage, and so on.
In vitro practical research had been carried out in a Jurkat T-cell line following stimulations of serum from myeloperoxidase-AAV sufferers. We discovered that solely the FTY720 remedy considerably alleviated hematuria and proteinuria, and diminished glomerular crescent formation, renal tubulointerstitial lesions and pulmonary hemorrhage in EAV.
The attenuation was accompanied by much less renal T-cell infiltration, up-regulated mRNA of S1PR1 and down-regulated IL-1β in kidneys, however not altered circulating ANCA ranges, suggesting that the therapeutic results of FTY720 had been B-cell impartial. Additional in vitro research demonstrated that FTY720 incubation might considerably inhibit the proliferation, adhesion, and migration, and enhance apoptosis of T cells.
In conclusion, the S1P modulator FTY720 might attenuate EAV by means of the discount and inhibition of T cells, which could develop into a novel remedy of ANCA-associated vasculitis.

Inflammatory Circumstances Disrupt Constitutive Endothelial Cell Barrier Stabilization by Assuaging Autonomous Secretion of Sphingosine 1-Phosphate.

The breakdown of the endothelial cell (EC) barrier contributes considerably to sepsis mortality. Sphingosine 1-phosphate (S1P) is without doubt one of the simplest EC barrier-stabilizing signaling molecules. Stabilization is principally transduced by way of the S1P receptor kind 1 (S1PR1). Right here, we exhibit that S1P was autonomously produced by ECs. S1P secretion was considerably increased in main human umbilical vein endothelial cells (HUVEC) in comparison with the endothelial cell line EA.hy926.
Constitutive barrier stability of HUVEC, however not EA.hy926, was considerably compromised by the S1PR1 antagonist W146 and by the anti-S1P antibody Sphingomab. HUVEC and EA.hy926 differed within the expression of the S1P-transporter Spns2, which allowed HUVEC, however not EA.hy926, to secrete S1P into the extracellular house. Spns2 poor mice confirmed elevated serum albumin leakage in bronchoalveolar lavage fluid (BALF).
Lung ECs remoted from Spns2 poor mice revealed elevated leakage of fluorescein isothiocyanate (FITC) labeled dextran and decreased resistance in electrical cell-substrate impedance sensing (ECIS) measurements. Spns2 was down-regulated in HUVEC after stimulation with pro-inflammatory cytokines and lipopolysaccharides (LPS), which contributed to destabilization of the EC barrier.
Our work suggests a brand new mechanism for barrier integrity upkeep. Secretion of S1P by EC by way of Spns2 contributed to constitutive EC barrier upkeep, which was disrupted below inflammatory circumstances by way of the down-regulation of the S1P-transporter Spns2.

The mechanism of the premetastatic area of interest facilitating colorectal most cancers liver metastasis generated from myeloid-derived suppressor cells induced by the S1PR1-STAT3 signaling pathway.

The tumor-derived elements concerned within the growth and accumulation of myeloid-derived suppressor cells (MDSCs) in metastatic dissemination of colorectal most cancers (CRC) to the liver has not been studied. Immunohistochemistry was used to detect sphingosine-1-phosphate receptor 1 (S1PR1) and sign transducer and activator of transcription-3 (STAT3) in human colorectal tumors. IL-6 and interferon-γ had been detected by enzyme-linked immunosorbent assay (ELISA).
Tumor progress, invasion, and migration had been evaluated by MTT, transwell, and wound therapeutic assays, respectively. Subcutaneous tumor-bearing and CRC liver metastasis (CRLM) nude mouse fashions had been constructed. The proportion of MDSCs was measured utilizing multicolor movement cytometry.
Western blot assay was used to guage S1PR1 and p-STAT3 expression in MDSCs after separation from the liver and tumor by magnetic antibody. T-cell suppression assay was detected by carboxyfluorescein succinimidyl ester (CFSE). Aberrant co-expressed S1PR1 and p-STAT3 was correlated with metachronous liver metastasis and poor prognosis in CRC. A mutual activation loop between S1PR1 and STAT3 can improve CRC cell proliferation, migration, and invasion in vitro and in vivo.
The expression of p-STAT3 and its downstream proteins might be regulated by S1PR1. p-STAT3 was the dependent signaling pathway of S1PR1 within the promotion of cell progress and liver metastasis in CRC. The extent of IL-6 and the related MDSCs stimulated by the S1PR1-STAT3 correlated with the variety of liver metastatic nodes within the CRLM mouse fashions and sufferers. Elevated CD14+HLA-DR-/low MDSCs from CRLM sufferers inhibited autologous T-cell proliferation and predict poor prognosis.
The S1PR1-STAT3-IL-6-MDSCs axis operates in each tumor cells and MDSCs concerned within the promotion of progress and liver metastasis in CRC. MDSCs induced by S1PR1-STAT3 in CRC cells fashioned the premetastatic area of interest within the liver can promote organ-specific metastasis.

Sphingosine 1-phosphate however not Fingolimod protects neurons in opposition to excitotoxic cell dying by inducing neurotrophic gene expression in astrocytes.

Sphingosine 1-phosphate (S1P) is a necessary lipid metabolite that indicators by means of a household of 5 G-protein coupled receptors, S1PR1-S1PR5, to control cell physiology. The a number of sclerosis drug Fingolimod is a potent S1P receptor agonist that causes peripheral lymphopenia. Latest analysis has demonstrated direct neuroprotective properties of FTY720 in a number of neurodegenerative paradigms, nonetheless neuroprotective properties of the native ligand S1P haven’t been established.
We aimed to determine the importance of neurotrophic issue up-regulation by S1P for neuroprotection, evaluating S1P with FTY720. S1P induced brain-derived neurotrophic issue, leukemia inhibitory issue, platelet-derived progress issue B and heparin-binding EGF-like progress issue gene expression in main human and murine astrocytes, however not in neurons, and to a a lot larger extent than FTY720.
Accordingly, S1P however not FTY720 protected cultured neurons in opposition to excitotoxic cell dying in a main murine neuron-glia co-culture mannequin, and a neutralizing antibody to LIF blocked this S1P-mediated neuroprotection. Antagonists of S1PR1 and S1PR2 each inhibited S1P-mediated neurotrophic gene induction in human astrocytes, indicating that simultaneous activation of each receptors is required.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

DLR-S1PR1-Hu-96T 96T
EUR 673
  • Should the Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

DLR-S1PR1-Mu-48T 48T
EUR 527
  • Should the Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

DLR-S1PR1-Mu-96T 96T
EUR 688
  • Should the Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RDR-S1PR1-Hu-48Tests 48 Tests
EUR 544

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RDR-S1PR1-Hu-96Tests 96 Tests
EUR 756

Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RDR-S1PR1-Mu-48Tests 48 Tests
EUR 557

Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RDR-S1PR1-Mu-96Tests 96 Tests
EUR 774

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RD-S1PR1-Hu-48Tests 48 Tests
EUR 521

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RD-S1PR1-Hu-96Tests 96 Tests
EUR 723

Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RD-S1PR1-Mu-48Tests 48 Tests
EUR 533

Mouse Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RD-S1PR1-Mu-96Tests 96 Tests
EUR 740

S1PR1 antibody

70R-20069 50 ul
EUR 435
Description: Rabbit polyclonal S1PR1 antibody

S1PR1 Antibody

37288-100ul 100ul
EUR 252

S1PR1 Antibody

1-CSB-PA002247
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/5000

S1PR1 Antibody

1-CSB-PA193689
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

S1PR1 Antibody

1-CSB-PA241754
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

S1PR1 Antibody

1-CSB-PA020650GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: 0.1M NaHCO3, 0.1M Glycine, 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

S1PR1 Antibody

1-CSB-PA020650LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

S1PR1 Antibody

1-CSB-PA007898
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

S1PR1 Conjugated Antibody

C37288 100ul
EUR 397

S1PR1 Polyclonal Antibody

A50464 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-S1PR1 antibody

STJ114801 100 µl
EUR 277
Description: The protein encoded by this gene is structurally similar to G protein-coupled receptors and is highly expressed in endothelial cells. It binds the ligand sphingosine-1-phosphate with high affinity and high specificity, and suggested to be involved in the processes that regulate the differentiation of endothelial cells. Activation of this receptor induces cell-cell adhesion. Alternative splicing results in multiple transcript variants.

S1PR1 siRNA

20-abx904763
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

S1PR1 siRNA

20-abx932372
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

S1PR1 siRNA

20-abx932373
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

S1PR1 Antibody, HRP conjugated

1-CSB-PA020650LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

S1PR1 Antibody, FITC conjugated

1-CSB-PA020650LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

S1PR1 Antibody, Biotin conjugated

1-CSB-PA020650LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against S1PR1. Recognizes S1PR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-S1PR1 (T236) Antibody

1-CSB-PA007881
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-S1PR1 (T236). Recognizes Phospho-S1PR1 (T236) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;IF:1/200-1/1000.ELISA:1/10000

anti- S1PR1/EDG1 antibody

FNab07568 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:2000
  • Immunogen: sphingosine-1-phosphate receptor 1
  • Uniprot ID: P21453
  • Gene ID: 1901
  • Research Area: Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against S1PR1/EDG1

Anti-S1PR1/EDG1 antibody

PAab07568 100 ug
EUR 386

S1PR1 Rabbit pAb

A12935-100ul 100 ul
EUR 308

S1PR1 Rabbit pAb

A12935-200ul 200 ul
EUR 459

S1PR1 Rabbit pAb

A12935-20ul 20 ul
EUR 183

S1PR1 Rabbit pAb

A12935-50ul 50 ul
EUR 223

S1PR1 cloning plasmid

CSB-CL020650HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1149
  • Sequence: atggggcccaccagcgtcccgctggtcaaggcccaccgcagctcggtctctgactacgtcaactatgatatcatcgtccggcattacaactacacgggaaagctgaatatcagcgcggacaaggagaacagcattaaactgacctcggtggtgttcattctcatctgctgcttta
  • Show more
Description: A cloning plasmid for the S1PR1 gene.

S1PR1-MO-1

HY-U00366 5mg
EUR 4513

Polyclonal S1PR1 / EDG1 / S1P1 Antibody

APR02818G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human S1PR1 / EDG1 / S1P1 . This antibody is tested and proven to work in the following applications:

S1PR1 Polyclonal Antibody, HRP Conjugated

A50465 100 µg
EUR 570.55
Description: The best epigenetics products

S1PR1 Polyclonal Antibody, FITC Conjugated

A50466 100 µg
EUR 570.55
Description: kits suitable for this type of research

S1PR1 Polyclonal Antibody, Biotin Conjugated

A50467 100 µg
EUR 570.55
Description: fast delivery possible

Human S1PR1 ELISA Kit

ELA-E1433h 96 Tests
EUR 824

S1PR1 ELISA KIT|Human

EF005984 96 Tests
EUR 689

Rat S1PR1 shRNA Plasmid

20-abx985698
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse S1PR1 shRNA Plasmid

20-abx970102
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human S1PR1 shRNA Plasmid

20-abx951322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
S1PR2 signaling was transduced by means of Gα13 and the small GTPase Rho, and was mandatory for up-regulation and activation of the transcription elements FOS and JUN, which regulate LIF, BDNF and HBEGF transcription. In abstract, we present that S1P protects hippocampal neurons in opposition to excitotoxic cell dying by means of up-regulation of neurotrophic gene expression, significantly LIF, in astrocytes.

Leave a Reply

Your email address will not be published. Required fields are marked *